Stem-loop sequence tgu-mir-363

AccessionMI0013690 (change log)
DescriptionTaeniopygia guttata miR-363 stem-loop
Gene family MIPF0000138; mir-363
Stem-loop
          u   gu         ca  a         ga  aguu 
5' guuuugc guu  cggguggau  cg ugcaauuuu  uu    u
   ||||||| |||  |||||||||  || |||||||||  ||     
3' cagaacg caa  gucuaccua  gc acguuaaaa  ag    a
          c   au         ug  -         ag  gaug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr4A: 7274550-7274638 [+]
intergenic
Clustered miRNAs
< 10kb from tgu-mir-363
tgu-mir-106chr4A: 7273746-7273818 [+]
tgu-mir-18bchr4A: 7273805-7273936 [+]
tgu-mir-20bchr4A: 7274092-7274164 [+]
tgu-mir-19b-2chr4A: 7274224-7274296 [+]
tgu-mir-92-2chr4A: 7274404-7274495 [+]
tgu-mir-363chr4A: 7274550-7274638 [+]
Database links

Mature sequence tgu-miR-363-5p

Accession MIMAT0026972
Sequence

17 - 

guggaucacgaugcaauuuuga

 - 38

Get sequence
Evidence experimental; Illumina [2]

Mature sequence tgu-miR-363-3p

Accession MIMAT0014501
Sequence

57 - 

aauugcacgguauccaucugu

 - 77

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).