![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence tgu-mir-200a |
||||||
Accession | MI0013759 (change log) | |||||
Description | Taeniopygia guttata miR-200a stem-loop | |||||
Gene family | MIPF0000019; mir-8 | |||||
Stem-loop |
ggacuugcugguccu g - c uuugcu 5' cu ugggcauc uuacuagacagug ugga g || |||||||| ||||||||||||| |||| 3' ga auuuguag aauggucugucac aucu c ----------agugg a c a caucuc |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence tgu-miR-200a-5p |
|
Accession | MIMAT0014640 |
Previous IDs | tgu-miR-200a* |
Sequence |
23 - caucuuacuagacagugcugg - 43 |
Evidence | experimental; 454 [1], Illumina [1-2] |
Mature sequence tgu-miR-200a-3p |
|
Accession | MIMAT0014545 |
Previous IDs | tgu-miR-200a |
Sequence |
61 - uaacacugucugguaacgauguu - 83 |
Evidence | experimental; 454 [1], Illumina [1-2] |
References |
|
1 |
PMID:20360741
"The genome of a songbird"
Nature. 464:757-762(2010).
|
2 |
PMID:23268654
"Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression"
BMC Genomics. 13:727(2012).
|