Stem-loop sequence tgu-mir-200a

AccessionMI0013759 (change log)
DescriptionTaeniopygia guttata miR-200a stem-loop
Gene family MIPF0000019; mir-8
Stem-loop 
   ggacuugcugguccu  g        -             c    uuugcu 
5'                cu ugggcauc uuacuagacagug ugga      g
                  || |||||||| ||||||||||||| ||||       
3'                ga auuuguag aauggucugucac aucu      c
   ----------agugg  a        c             a    caucuc
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr21: 5894308-5894400 [+]
sense
ENSTGUT00000018362 ; tgu-mir-200a-201; exon 1
Clustered miRNAs
< 10kb from tgu-mir-200a
tgu-mir-200bchr21: 5892896-5892968 [+]
tgu-mir-200achr21: 5894308-5894400 [+]
Database links

Mature sequence tgu-miR-200a-5p

Accession MIMAT0014640
Previous IDstgu-miR-200a*
Sequence

23 -  

caucuuacuagacagugcugg

 - 43

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence tgu-miR-200a-3p

Accession MIMAT0014545
Previous IDstgu-miR-200a
Sequence

61 -  

uaacacugucugguaacgauguu

 - 83

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).