Stem-loop sequence tgu-mir-490-1

AccessionMI0013763 (change log)
DescriptionTaeniopygia guttata miR-490-1 stem-loop
Gene family MIPF0000229; mir-490
Stem-loop
   ucaugaguucaugc       c      --         g   caagaua 
5'               uucgaca caugga  ucuccaggu ggu       a
                 ||||||| ||||||  ||||||||| |||       u
3'               gagcugu guaccu  ggaggucca cca       a
   --------cuuguc       c      ca         a   cauagag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chrUn: 87366743-87366835 [+]
sense
ENSTGUT00000018266 ; tgu-mir-490-1-201; exon 1
Database links

Mature sequence tgu-miR-490-5p

Accession MIMAT0026996
Sequence

22 - 

ccauggaucuccaggugggu

 - 41

Get sequence
Evidence experimental; Illumina [2]

Mature sequence tgu-miR-490-3p

Accession MIMAT0014548
Sequence

61 - 

caaccuggaggacuccaugcugu

 - 83

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).