![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence tgu-mir-32 |
|||||
Accession | MI0013812 (change log) | ||||
Description | Taeniopygia guttata miR-32 stem-loop | ||||
Gene family | MIPF0000069; mir-32 | ||||
Stem-loop |
cugguggaga u guucuc 5' uauugcacau acuaaguugcac a |||||||||| |||||||||||| c 3' auagcgugug ugauuuaacgug g ---------c - acuccg |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence tgu-miR-32 |
|
Accession | MIMAT0014584 |
Sequence |
11 - uauugcacauuacuaaguugc - 31 |
Evidence | experimental; 454 [1], Illumina [2] |
References |
|
1 |
PMID:20360741
"The genome of a songbird"
Nature. 464:757-762(2010).
|
2 |
PMID:23268654
"Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression"
BMC Genomics. 13:727(2012).
|