Stem-loop sequence tgu-mir-2962

AccessionMI0013649 (change log)
DescriptionTaeniopygia guttata miR-2962 stem-loop
Stem-loop
       ug             c    a          --a   g 
5' gccc  ggaaggggaggag gagg aggggauggg   ugg c
   ||||  ||||||||||||| |||| ||||||||||   ||| u
3' cggg  ccuuucccucuuc cucc uccccuaccu   acc a
       gu             u    g          ggg   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr17: 6428017-6428101 [+]
intergenic
Database links

Mature sequence tgu-miR-2962-5p

Accession MIMAT0014462
Previous IDstgu-miR-2962
Sequence

15 - 

aggagcgaggaaggggauggga

 - 36

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence tgu-miR-2962-3p

Accession MIMAT0014621
Previous IDstgu-miR-2962*
Sequence

53 - 

cauccccugccucucuucucc

 - 73

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).