Stem-loop sequence api-mir-92a-1

AccessionMI0013944 (change log)
DescriptionAcyrthosiphon pisum miR-92a-1 stem-loop
Gene family MIPF0001099; mir-92_2
Literature search

1 open access papers mention api-mir-92a-1
(1 sentences)

Stem-loop
   --      uc   u       c    -  acaauu 
5'   uggucg  gac ugugcaa uauu gu      u
     ||||||  ||| ||||||| |||| ||       
3'   accggc  cug acacguu auaa ca      u
   ua      -c   u       -    u  gacuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350511.1: 42264-42330 [+]
intergenic
Clustered miRNAs
< 10kb from api-mir-92a-1
api-mir-92a-1GL350511.1: 42264-42330 [+]
api-mir-92b-1GL350511.1: 42426-42507 [+]
Database links

Mature sequence api-miR-92a

Accession MIMAT0014742
Sequence

46 - 

uauugcacaugucccggccaau

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).