Stem-loop sequence mmu-mir-3076

AccessionMI0014039 (change log)
Symbol MGI:Mir3076
DescriptionMus musculus miR-3076 stem-loop
Stem-loop
   -aca         -  -c     ca  cuuu 
5'     caggggaag cu  agugc  gc    c
       ||||||||| ||  |||||  ||     
3'     guucccuuc gg  ucacg  cg    u
   agac         u  uc     -c  auuc 
Get sequence
Deep sequencing
666 reads, 1.3 reads per million, 77 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr14: 30572149-30572208 [+]
sense
OTTMUST00000089041 ; Tkt-001; intron 12
ENSMUST00000022529 ; Tkt-001; intron 12
Database links

Mature sequence mmu-miR-3076-5p

Accession MIMAT0014860
Sequence

2 - 

cacaggggaagcucagugccagcc

 - 25

Get sequence
Deep sequencing96 reads, 48 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-3076-3p

Accession MIMAT0014861
Sequence

37 - 

cgcacucuggucuucccuugcag

 - 59

Get sequence
Deep sequencing570 reads, 65 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).