Stem-loop sequence mmu-mir-3090

AccessionMI0014083 (change log)
Symbol MGI:Mir3090
DescriptionMus musculus miR-3090 stem-loop
Literature search

1 open access papers mention mmu-mir-3090
(7 sentences)

Stem-loop
      -   u c     -   u     gg     a  uc  g auu 
5' uuc cug c cagug guc gggug  gccug ga  cu a   u
   ||| ||| | ||||| ||| |||||  ||||| ||  || |    
3' agg gac g gucac cag cccac  uggac cu  ga u   c
      a   c u     u   u     ag     c  -c  g aau 
Get sequence
Deep sequencing
106 reads, 11.8 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 133564708-133564794 [+]
intergenic
Database links

Mature sequence mmu-miR-3090-5p

Accession MIMAT0014901
Previous IDsmmu-miR-3090*
Sequence

15 - 

gucuggguggggccugagauc

 - 35

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-3090-3p

Accession MIMAT0014902
Previous IDsmmu-miR-3090
Sequence

53 - 

ucccaggugacacccugacuca

 - 74

Get sequence
Deep sequencing97 reads, 14 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).