Stem-loop sequence mmu-mir-3092

AccessionMI0014085 (change log)
Symbol MGI:Mir3092
DescriptionMus musculus miR-3092 stem-loop
Literature search

1 open access papers mention mmu-mir-3092
(1 sentences)

Stem-loop
        -g  u    cu         au     uc      uuu - uga 
5' uaaga  gc ggac  gaggggaaa  gccuu  ucccag   c c   u
   |||||  || ||||  |||||||||  |||||  ||||||   | |    
3' auucu  cg ccug  cuccccuuu  cgggg  aggguc   g g   c
        aa  u    uc         gu     ua      --u u uuu 
Get sequence
Deep sequencing
118 reads, 0 reads per million, 38 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr3: 27584900-27584995 [-]
sense
ENSMUST00000046157 ; Fndc3b-201; intron 3
Database links

Mature sequence mmu-miR-3092-5p

Accession MIMAT0014905
Previous IDsmmu-miR-3092*
Sequence

17 - 

aggggaaaaugccuuucuccca

 - 38

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-3092-3p

Accession MIMAT0014906
Previous IDsmmu-miR-3092
Sequence

61 - 

gaauggggcuguuuccccucc

 - 81

Get sequence
Deep sequencing86 reads, 33 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).