Stem-loop sequence mmu-mir-3104

AccessionMI0014101 (change log)
Symbol MGI:Mir3104
DescriptionMus musculus miR-3104 stem-loop
Literature search

2 open access papers mention mmu-mir-3104
(2 sentences)

Stem-loop
   --  a    -    g   c     cc    - ug 
5'   cu gggg gcag agc ggagc  ucug c  a
     || |||| |||| ||| |||||  |||| |   
3'   ga cccc cguu ucg ucucg  agac g  a
   ua  c    u    -   -     -c    a uc 
Get sequence
Deep sequencing
51 reads, 25 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 141992179-141992241 [+]
sense
OTTMUST00000094917 ; Brsk2-006; 3'UTR (exon 7)
OTTMUST00000094922 ; Brsk2-011; exon 8
OTTMUST00000094920 ; Brsk2-009; 3'UTR (exon 9)
OTTMUST00000094919 ; Brsk2-010; 3'UTR (exon 12)
OTTMUST00000094910 ; Brsk2-001; 3'UTR (exon 13)
OTTMUST00000094911 ; Brsk2-002; exon 13
OTTMUST00000094913 ; Brsk2-004; 3'UTR (exon 13)
OTTMUST00000094915 ; Brsk2-005; 3'UTR (exon 13)
OTTMUST00000094916 ; Brsk2-007; 3'UTR (exon 13)
OTTMUST00000094912 ; Brsk2-003; 3'UTR (exon 14)
ENSMUST00000174309 ; Brsk2-006; 3'UTR (exon 7)
ENSMUST00000173705 ; Brsk2-011; exon 8
ENSMUST00000173924 ; Brsk2-009; 3'UTR (exon 9)
ENSMUST00000172967 ; Brsk2-010; 3'UTR (exon 12)
ENSMUST00000018971 ; Brsk2-001; 3'UTR (exon 13)
ENSMUST00000174405 ; Brsk2-002; exon 13
ENSMUST00000105989 ; Brsk2-004; 3'UTR (exon 13)
ENSMUST00000075528 ; Brsk2-005; 3'UTR (exon 13)
ENSMUST00000174499 ; Brsk2-007; 3'UTR (exon 13)
ENSMUST00000078200 ; Brsk2-201; 3'UTR (exon 13)
ENSMUST00000172652 ; Brsk2-003; 3'UTR (exon 14)
Database links

Mature sequence mmu-miR-3104-5p

Accession MIMAT0014939
Sequence

2 - 

uagggggcaggagccggagcccucu

 - 26

Get sequence
Deep sequencing10 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mmu-miR-3104-3p

Accession MIMAT0014940
Sequence

40 - 

acgcucugcuuugcucccccaga

 - 62

Get sequence
Deep sequencing39 reads, 9 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).