Stem-loop sequence hsa-mir-3152

Accession

MI0014179 (change log)

Symbol

HGNC:MIR3152

Description

Homo sapiens miR-3152 stem-loop

Literature search

3 open access papers mention hsa-mir-3152
(4 sentences)

Stem-loop

                                 -a  cu 
5' gugcagaguuauugccucuguucuaacaca  ga  a
   ||||||||||||||||||||||||||||||  ||  g
3' cacgucucaauaacggggauaagauugugu  cu  g
                                 cc  uc 

Deep sequencing

186 reads, 19.3 reads per million, 57 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

Berezikov et al. proposed this sequence as a miRNA candidate based on the RAKE method [1]. Stark et al. later validated its expression in human using high-throughput sequencing [2].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr9: 18573306-18573379 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000401206 ; ADAMTSL1-012; intron 3

  OTTHUMT00000051800 ; ADAMTSL1-001; intron 3

  OTTHUMT00000051803 ; ADAMTSL1-004; intron 3

  OTTHUMT00000051802 ; ADAMTSL1-003; intron 3

  OTTHUMT00000051801 ; ADAMTSL1-002; intron 3

  OTTHUMT00000051804 ; ADAMTSL1-005; intron 3

  ENST00000579801 ; MIR3152-201; exon 1

  ENST00000380548 ; ADAMTSL1-012; intron 3

  ENST00000327883 ; ADAMTSL1-001; intron 3

  ENST00000431052 ; ADAMTSL1-004; intron 3

  ENST00000380570 ; ADAMTSL1-003; intron 3

  ENST00000380566 ; ADAMTSL1-002; intron 3

  ENST00000276935 ; ADAMTSL1-005; intron 3

Database links

• EntrezGene:MIR3152
• HGNC:MIR3152
• miRBase Tracker:MI0014179

Mature sequence hsa-miR-3152-5p

• Accession: MIMAT0019207
• Sequence: 11 - auugccucuguucuaacacaag - 32
• Deep sequencing: 158 reads, 48 experiments
• Evidence: experimental; Illumina [4]
• Predicted targets:
  • TargetMiner:hsa-miR-3152-5p
  • TargetScanVert:hsa-miR-3152-5p
  • miRDB:hsa-miR-3152-5p

Mature sequence hsa-miR-3152-3p

• Accession: MIMAT0015025
• Previous IDs: hsa-miR-3152
• Sequence: 45 - uguguuagaauaggggcaauaa - 66
• Deep sequencing: 27 reads, 15 experiments
• Evidence: experimental; Illumina [2-4]
• Predicted targets:
  • TargetMiner:hsa-miR-3152-3p
  • TargetScanVert:hsa-miR-3152-3p
  • miRDB:hsa-miR-3152-3p
  • microrna.org:hsa-miR-3152-3p

References

1. PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
3. PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
4. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).