Stem-loop sequence cel-mir-358

AccessionMI0000757 (change log)
DescriptionCaenorhabditis elegans miR-358 stem-loop
Gene family MIPF0000226; mir-358
Stem-loop
   ---aaac    --     cug c     -   c   c  u    c    aaacuuac 
5'        ucgc  gacgg   g gaccu ggc agg au ccaa uguc        a
          ||||  |||||   | ||||| ||| ||| || |||| ||||        a
3'        agcg  uugcc   c cugga cug ucc ua gguu acag        a
   uugcuua    ac     uaa u     a   -   c  u    a    cucuuucg 
Get sequence
Deep sequencing
424 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was predicted by computational analysis of C. elegans and C. briggsae, and expression of the mature microRNA confirmed by PCR amplification, cloning and sequencing [1]. The extents of the dominant mature miRNA species are adjusted here in accordance with a large scale cloning and sequencing study [2].

Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrV: 8580858-8580967 [-]
antisense
F25G6.2 ; F25G6.2; intron 5
Clustered miRNAs
< 10kb from cel-mir-358
cel-mir-358chrV: 8580858-8580967 [-]
cel-mir-357chrV: 8580542-8580651 [-]
Database links

Mature sequence cel-miR-358-5p

Accession MIMAT0015120
Previous IDscel-miR-358*
Sequence

20 - 

accuggccaggcauuccaacugu

 - 42

Get sequence
Deep sequencing229 reads, 10 experiments
Evidence experimental; CLIPseq [4], Illumina [5]
Database links
Predicted targets

Mature sequence cel-miR-358-3p

Accession MIMAT0000700
Previous IDscel-miR-358
Sequence

67 - 

auugguaucccugucaaggucu

 - 88

Get sequence
Deep sequencing190 reads, 12 experiments
Evidence experimental; cloned [1-2], PCR [1], Illumina [3,5], CLIPseq [4]
Database links
Predicted targets

References

1
2
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
3
4
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).
5