Stem-loop sequence bmo-mir-2843-2

AccessionMI0012464 (change log)
DescriptionBombyx mori miR-2843-2 stem-loop
Gene family MIPF0001044; mir-2843
Stem-loop
   ggc     -  uc     aaa      cg   aca      -u   -    u 
5'    uuugg ag  uaagg   uuaggu  gau   uacgaa  uag ugcg a
      ||||| ||  |||||   ||||||  |||   ||||||  ||| ||||  
3'    aggcu uc  auucc   aguccg  cua   gugcuu  guc gugc u
   -aa     a  ua     -cc      aa   ---      cu   u    g 
Get sequence
Deep sequencing
1741 reads, 100 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004598019.1: 387-484 [-]
intergenic
NW_004618337.1: 252-349 [-]
intergenic
Database links

Mature sequence bmo-miR-2843-5p

Accession MIMAT0013762
Previous IDsbmo-miR-2843
Sequence

11 - 

ucuaaggaaauuaggucggauaca

 - 34

Get sequence
Deep sequencing3478 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence bmo-miR-2843-2-3p

Accession MIMAT0015307
Previous IDsbmo-miR-2843-2*
Sequence

63 - 

uucgugaucaagccugaccccuuaau

 - 88

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).