Stem-loop sequence aae-mir-263a

AccessionMI0013495 (change log)
DescriptionAedes aegypti miR-263a stem-loop
Gene family MIPF0000122; mir-263
Literature search

3 open access papers mention aae-mir-263a
(9 sentences)

Stem-loop
   ----------u   -     ac ua   g     ga    uu      u  auu 
5'            ccu aguac  g  aug cacug  agaa  cacggg au   u
              ||| |||||  |  ||| |||||  ||||  |||||| ||    
3'            gga ucaug  c  uac gugac  ucuu  gugccc ua   u
   gacuacuuagu   a     gu cc   g     gg    --      c  aag 
Get sequence
Deep sequencing
208702 reads, 1.04e+04 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.981: 164938-165034 [-]
intergenic
Database links

Mature sequence aae-miR-263a-5p

Accession MIMAT0014289
Previous IDsaae-miR-263a
Sequence

14 - 

aauggcacuggaagaauucacgg

 - 36

Get sequence
Deep sequencing204613 reads, 2 experiments
Evidence experimental; 454 [1]

Mature sequence aae-miR-263a-3p

Accession MIMAT0015372
Previous IDsaae-miR-263a*
Sequence

54 - 

cguguucuggcaguggcauccc

 - 75

Get sequence
Deep sequencing4089 reads, 2 experiments
Evidence experimental; 454 [1]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).