![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence aae-mir-263a |
|||||
Accession | MI0013495 (change log) | ||||
Description | Aedes aegypti miR-263a stem-loop | ||||
Gene family | MIPF0000122; mir-263 | ||||
Literature search |
3 open access papers mention aae-mir-263a | ||||
Stem-loop |
----------u - ac ua g ga uu u auu 5' ccu aguac g aug cacug agaa cacggg au u ||| ||||| | ||| ||||| |||| |||||| || 3' gga ucaug c uac gugac ucuu gugccc ua u gacuacuuagu a gu cc g gg -- c aag |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence aae-miR-263a-5p |
|
Accession | MIMAT0014289 |
Previous IDs | aae-miR-263a |
Sequence |
14 - aauggcacuggaagaauucacgg - 36 |
Deep sequencing | 204613 reads, 2 experiments |
Evidence | experimental; 454 [1] |
Mature sequence aae-miR-263a-3p |
|
Accession | MIMAT0015372 |
Previous IDs | aae-miR-263a* |
Sequence |
54 - cguguucuggcaguggcauccc - 75 |
Deep sequencing | 4089 reads, 2 experiments |
Evidence | experimental; 454 [1] |
References |
|
1 | |
2 |
PMID:20167119
"Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus"
BMC Genomics. 11:119(2010).
|