Stem-loop sequence bmo-mir-3259

AccessionMI0014315 (change log)
DescriptionBombyx mori miR-3259 stem-loop
Stem-loop
   c      agc      auugagua      -  a       cu    ga   agua 
5'  aagaga   ucuugu        caauug ac agaaaag  cuuu  uug    c
    ||||||   ||||||        |||||| || |||||||  ||||  |||    a
3'  uuuucu   agaaca        guuaac ug uuuuuuc  gaaa  aac    a
   u      aaa      --------      g  a       cc    ag   aguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582019.1: 5116402-5116507 [+]
intergenic
Database links

Mature sequence bmo-miR-3259

Accession MIMAT0015443
Sequence

83 - 

ugcaauugacaagaaaaucuuuu

 - 105

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).