Stem-loop sequence bmo-mir-3347a

AccessionMI0014405 (change log)
DescriptionBombyx mori miR-3347a stem-loop
Gene family MIPF0001022; mir-3347
Stem-loop
   gc     uuuau ua     ---g      cu  ucu u     -        ggcgguauua       -c    -  ua 
5'   ggaga     c  aacuu    ugggac  gu   g uuagu auguaugc          augagcu  ugcc ca  g
     |||||     |  |||||    ||||||  ||   | ||||| ||||||||          |||||||  |||| ||  c
3'   ccucu     g  uuggg    acucug  cg   c aguua uacaugcg          uacucgg  augg gu  a
   -c     ----u uc     auca      -u  -uu u     c        --------ag       ua    c  uc 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581736.1: 1374869-1375012 [-]
intergenic
NW_004617418.1: 473-616 [+]
intergenic
Database links

Mature sequence bmo-miR-3347a

Accession MIMAT0015533
Sequence

102 - 

uacaucauugaucuugcugucucaa

 - 126

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).