Stem-loop sequence bmo-mir-3382

AccessionMI0014443 (change log)
DescriptionBombyx mori miR-3382 stem-loop
Stem-loop
   u    g   uu    - --      uu  gu  u     uc  gc   uc   ga cuc         
5'  ccgc ucg  gccu c  uucaag  uu  gu cuggg  gu  cgg  gcg  g   ucguaugu 
    |||| |||  |||| |  ||||||  ||  || |||||  ||  |||  |||  |   ||||||| u
3'  ggug agc  ugga g  aaguuc  ag  ca ggccu  cg  guc  cgc  c   agcaugcu 
   c    -   -u    c cc      uu  gu  -     -c  uu   uu   ug ---         
Get sequence
Deep sequencing
55 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004620848.1: 33-157 [+]
intergenic
Database links

Mature sequence bmo-miR-3382-5p

Accession MIMAT0015575
Previous IDsbmo-miR-3382
Sequence

18 - 

ucaaguuuuguguucugggucgu

 - 40

Get sequence
Deep sequencing41 reads, 3 experiments
Evidence experimental; SOLID [1]

Mature sequence bmo-miR-3382-3p

Accession MIMAT0015576
Previous IDsbmo-miR-3382*
Sequence

86 - 

ugccuccggacuggauucuugaacc

 - 110

Get sequence
Deep sequencing12 reads, 2 experiments
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).