Stem-loop sequence bmo-mir-3402

AccessionMI0014465 (change log)
DescriptionBombyx mori miR-3402 stem-loop
Stem-loop
   - gg  a  -   c aaaagau   -   caa         acc  u    u   a   gagu 
5'  g  ua ag gcc g       cca cug   uaacuuuaa   gc gagc gga cug    c
    |  || || ||| |       ||| |||   |||||||||   || |||| ||| |||     
3'  c  au uc cgg c       ggu ggc   auugaaauu   cg cucg ccu gau    u
   a au  c  a   u --gccau   c   -ag         ---  -    c   -   gagg 
Get sequence
Deep sequencing
9 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581799.1: 344225-344341 [+]
intergenic
Database links

Mature sequence bmo-miR-3402

Accession MIMAT0015606
Sequence

25 - 

ugcaauaacuuuaaaccgcugagcu

 - 49

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).