Stem-loop sequence bmo-mir-3406

AccessionMI0014470 (change log)
DescriptionBombyx mori miR-3406 stem-loop
Stem-loop
   c        --a       --ga   gauaa     a ua   c     aug       -u  uc 
5'  guucgcau   uuuagau    ugu     uagua g  gca guuug   agcaugu  ag  u
    ||||||||   |||||||    |||     ||||| |  ||| |||||   |||||||  ||  u
3'  uaagugug   agauuua    aca     aucgu c  cgu cgaac   uugugcg  uc  c
   u        aaa       auua   aucua     a cg   -     aga       cu  uu 
Get sequence
Deep sequencing
189 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581707.1: 1075057-1075183 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-3406
bmo-mir-3406NW_004581707.1: 1075057-1075183 [+]
bmo-mir-3414NW_004581707.1: 1075363-1075462 [-]
Database links

Mature sequence bmo-miR-3406-5p

Accession MIMAT0015611
Previous IDsbmo-miR-3406
Sequence

28 - 

uaguaaguagcacguuugaugagca

 - 52

Get sequence
Deep sequencing188 reads, 3 experiments
Evidence experimental; SOLID [1]
Database links

Mature sequence bmo-miR-3406-3p

Accession MIMAT0015612
Previous IDsbmo-miR-3406*
Sequence

68 - 

ucgcguguuagacaagcugcgccaugcu

 - 95

Get sequence
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).