Stem-loop sequence mmu-mir-3474

AccessionMI0014707 (change log)
Symbol MGI:Mir3474
DescriptionMus musculus miR-3474 stem-loop
Stem-loop
   ------c       g      ug   u uuu 
5'        ccuggga gagacg  gau c   a
          ||||||| ||||||  ||| |    
3'        ggaccuu uucugc  cua g   g
   ucgacuu       g      gu   c uga 
Get sequence
Deep sequencing
1725 reads, 0 reads per million, 65 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 158638583-158638640 [+]
sense
OTTMUST00000037866 ; Actr5-004; exon 8
OTTMUST00000037863 ; Actr5-001; 3'UTR (exon 9)
OTTMUST00000037864 ; Actr5-002; exon 11
ENSMUST00000142531 ; Actr5-004; exon 8
ENSMUST00000045644 ; Actr5-001; 3'UTR (exon 9)
ENSMUST00000183731 ; Actr5-002; exon 11
Database links

Mature sequence mmu-miR-3474

Accession MIMAT0015646
Sequence

1 - 

cccugggaggagacguggauuc

 - 22

Get sequence
Deep sequencing1721 reads, 62 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).