Stem-loop sequence ppy-mir-363

AccessionMI0014910 (change log)
DescriptionPongo pygmaeus miR-363 stem-loop
Gene family MIPF0000138; mir-363
Stem-loop
   u   gu         ca  a         --ga   gu 
5'  guu  cggguggau  cg ugcaauuuu    uua  a
    |||  |||||||||  || |||||||||    |||   
3'  caa  gucuaccua  gc acguuaaaa    gau  u
   c   au         ug  -         agag   ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chrX: 133612303-133612377 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-363
ppy-mir-106achrX: 133613123-133613203 [-]
ppy-mir-18bchrX: 133612966-133613036 [-]
ppy-mir-20bchrX: 133612734-133612802 [-]
ppy-mir-19b-2chrX: 133612596-133612691 [-]
ppy-mir-92-2chrX: 133612463-133612537 [-]
ppy-mir-363chrX: 133612303-133612377 [-]
Database links

Mature sequence ppy-miR-363

Accession MIMAT0015852
Sequence

50 - 

aauugcacgguauccaucugua

 - 71

Get sequence
Evidence not experimental

References

1