Stem-loop sequence ppy-mir-367

AccessionMI0014913 (change log)
DescriptionPongo pygmaeus miR-367 stem-loop
Gene family MIPF0000162; mir-367
Stem-loop
                   ua     c    -      
5' ccauuacuguugcuaa  ugcaa ucug uuuaa 
   ||||||||||||||||  ||||| |||| |||| u
3' gguagugguaacgauu  acguu aggu aaaua 
                   uc     a    u      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr4: 117393857-117393924 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-367
ppy-mir-302bchr4: 117394496-117394571 [-]
ppy-mir-302cchr4: 117394361-117394428 [-]
ppy-mir-302dchr4: 117393985-117394052 [-]
ppy-mir-367chr4: 117393857-117393924 [-]
Database links

Mature sequence ppy-miR-367

Accession MIMAT0015854
Sequence

44 - 

aauugcacuuuagcaaugguga

 - 65

Get sequence
Evidence not experimental

References

1