Stem-loop sequence ppy-mir-508

AccessionMI0014981 (change log)
DescriptionPongo pygmaeus miR-508 stem-loop
Gene family MIPF0000130; mir-506
Stem-loop
   ---------ccaccuucagcuga     g   c      c       gu  c   c  aaa 
5'                        gugua ugc cuacuc agagggc  ca uca gu   c
                          ||||| ||| |||||| |||||||  || ||| ||    
3'                        cacau aug gaugag uuuuccg  gu agu ca   u
   ggugguuuauacggaaugcacua     a   a      u       au  u   a  aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chrX: 147125085-147125199 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-508
ppy-mir-508chrX: 147125085-147125199 [-]
ppy-mir-507chrX: 147116183-147116272 [-]
ppy-mir-506chrX: 147115915-147116038 [-]
Database links

Mature sequence ppy-miR-508-5p

Accession MIMAT0015931
Sequence

26 - 

uacuccagagggcgucacucacg

 - 48

Get sequence
Evidence not experimental

Mature sequence ppy-miR-508-3p

Accession MIMAT0015932
Sequence

61 - 

ugauuguagccuuuuugaguaga

 - 83

Get sequence
Evidence not experimental

References

1