Stem-loop sequence ppy-mir-527

AccessionMI0015036 (change log)
DescriptionPongo pygmaeus miR-527 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
        u        u    -          c      guug  u 
5' ucuca gcugugac cugc aaagggaagc cuuucu    uc a
   ||||| |||||||| |||| |||||||||| ||||||    || a
3' agagu uggcauug gaug uuucccuucg gaaaga    ag a
        u        -    g          u      --aa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr19: 55533164-55533250 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-527
ppy-mir-521-1chr19: 55526919-55527005 [+]
ppy-mir-522chr19: 55531030-55531116 [+]
ppy-mir-527chr19: 55533164-55533250 [+]
ppy-mir-516a-2chr19: 55535304-55535419 [+]
ppy-mir-518a-2chr19: 55536834-55536949 [+]
ppy-mir-516a-1chr19: 55541606-55541695 [+]
ppy-mir-519achr19: 55542821-55542903 [+]
Database links

Mature sequence ppy-miR-527

Accession MIMAT0015986
Sequence

16 - 

cugcaaagggaagcccuuuc

 - 35

Get sequence
Evidence not experimental

References

1