Stem-loop sequence ppy-mir-615

AccessionMI0015100 (change log)
DescriptionPongo pygmaeus miR-615 stem-loop
Gene family MIPF0000342; mir-615
Stem-loop
   cuc   -a    c      g  uuc     u        cu    g ug 
5'    ggg  gggg gggagg gg   cccgg gcucggau  cgag g  c
      |||  |||| |||||| ||   ||||| ||||||||  |||| |  u
3'    ccc  cccc ccuucu cc   ggguc cgagccug  gcuu u  u
   ccc   aa    -      g  ucu     -        --    g ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr12: 53810378-53810473 [+]
intergenic
Database links

Mature sequence ppy-miR-615-5p

Accession MIMAT0016056
Sequence

17 - 

ggggguuccccggugcucggauc

 - 39

Get sequence
Evidence not experimental

Mature sequence ppy-miR-615-3p

Accession MIMAT0016057
Sequence

61 - 

uccgagccugggucuccgucuu

 - 82

Get sequence
Evidence not experimental

References

1