Stem-loop sequence ppy-mir-631

AccessionMI0015112 (change log)
DescriptionPongo pygmaeus miR-631 stem-loop
Gene family MIPF0000508; mir-631
Stem-loop
   gu      cc    uaga      c   a  -      a 
5'   ggggag  uggu    ccuggc cag cc ucagcu c
     ||||||  ||||    |||||| ||| || |||||| a
3'   ccucuc  accg    ggacug guc gg agucga c
   --      ac    ---g      a   a  u      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr15: 72821876-72821950 [-]
intergenic
Database links

Mature sequence ppy-miR-631

Accession MIMAT0016070
Sequence

16 - 

agaccuggcccagaccucagc

 - 36

Get sequence
Evidence not experimental

References

1