Stem-loop sequence ppy-mir-658

AccessionMI0015132 (change log)
DescriptionPongo pygmaeus miR-658 stem-loop
Gene family MIPF0000643; mir-658
Stem-loop
   g    ---guu    ugguu  a    --cgg   gc     --agc    ug 
5'  cucg      gccg     gc ggcc     ccc  ccgcc     ucgc  a
    ||||      ||||     || ||||     |||  |||||     ||||  c
3'  gagc      uggc     ug cugg     ggg  ggcgg     agcg  a
   g    aagggu    -uggu  c    augaa   -a     gacuc    cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr22: 33016589-33016688 [-]
intergenic
Database links

Mature sequence ppy-miR-658

Accession MIMAT0016091
Sequence

61 - 

ggcggagggaaguagguccguuggu

 - 85

Get sequence
Evidence not experimental

References

1