Stem-loop sequence ppy-mir-939

AccessionMI0015174 (change log)
DescriptionPongo pygmaeus miR-939 stem-loop
Gene family MIPF0000490; mir-939
Stem-loop
   u    -    gu         u       ug     -   c 
5'  gugg cagg  cuggggagc gaggcuc  ggagu ggc g
    |||| ||||  ||||||||| |||||||  ||||| |||  
3'  cgcc gucu  gaccccucg cuccggg  ucuca ucg g
   g    a    gu         u       --     g   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr8: 152754611-152754690 [-]
intergenic
Database links

Mature sequence ppy-miR-939

Accession MIMAT0016139
Sequence

13 - 

uggggagcugaggcucugggagug

 - 36

Get sequence
Evidence not experimental

References

1