Stem-loop sequence ppy-mir-1283b

AccessionMI0015239 (change log)
DescriptionPongo pygmaeus miR-1283b stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   --    u        u  g           c      guug  u 
5'   cuca gcugugac cu caaagggaagc cuuucu    uc a
     |||| |||||||| || ||||||||||| ||||||    || a
3'   gagu uggcauug ga guuucccuucg gaaaga    ag a
   aa    u        u  g           c      --aa  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ppy-miR-1283b

Accession MIMAT0016205
Sequence

14 - 

ucugcaaagggaagcccuuucu

 - 35

Get sequence
Evidence not experimental

References

1