Stem-loop sequence ppy-mir-1301

AccessionMI0015255 (change log)
DescriptionPongo pygmaeus miR-1301 stem-loop
Gene family MIPF0000742; mir-1301
Stem-loop
   --        g           -     - c      -  gu 
5'   ggauugug ggggucgcucu aggca c gcagca cu  g
     |||||||| ||||||||||| ||||| | |||||| ||  c
3'   ccugacac cuucagugagg uccgu g cguugu gg  u
   cu        a           g     c a      a  gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr2A: 86862760-86862841 [+]
intergenic
Database links

Mature sequence ppy-miR-1301

Accession MIMAT0016221
Sequence

48 - 

uugcagcugccugggagugacuuc

 - 71

Get sequence
Evidence not experimental

References

1