Stem-loop sequence ppy-mir-1915

AccessionMI0015281 (change log)
DescriptionPongo pygmaeus miR-1915 stem-loop
Gene family MIPF0001037; mir-1915
Stem-loop
   ugagaggccucaccuugac      ccc       g a -     -g   c 
5'                    uugcug   gggccgu c c ccgug  gcc c
                      ||||||   ||||||| | | |||||  |||  
3'                    agcgau   cccggcg g g ggcgc  cgg a
   -------------------      ---       g g c     ag   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr10: 22434623-22434702 [-]
intergenic
Database links

Mature sequence ppy-miR-1915

Accession MIMAT0016243
Sequence

47 - 

ccccagggcgacgcggcggg

 - 66

Get sequence
Evidence not experimental

References

1