Stem-loop sequence sja-mir-310

AccessionMI0015298 (change log)
DescriptionSchistosoma japonicum miR-310 stem-loop
Literature search

1 open access papers mention sja-mir-310
(2 sentences)

Stem-loop
   guagaga   ggga     --a     gaugacgcgacucucguggagaguacuuauccgaagaugacuucau 
5'        auu    gauau   gucaa                                              c
          |||    |||||   |||||                                              g
3'        uaa    uugua   uaguu                                              a
   ----cag   -aag     agg     uccggcccuuaaacguuauaaguggcugguauuuggugacugcaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15177v1; GCA_000151775.1) Overlapping transcripts
CABF01020650.1: 1788-1929 [-]
intergenic
Database links

Mature sequence sja-miR-310

Accession MIMAT0016271
Sequence

101 - 

auauugcaaauucccggccuuu

 - 122

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).