Stem-loop sequence sja-mir-3479

AccessionMI0015300 (change log)
DescriptionSchistosoma japonicum miR-3479 stem-loop
Gene family MIPF0001629; mir-3479
Literature search

5 open access papers mention sja-mir-3479
(35 sentences)

Stem-loop
   --c       ug       u  u        u  guga 
5'    auguuug  aggugga gu agugcaau ua    c
      |||||||  ||||||| || |||||||| ||     
3'    uauaaac  uccgcuu ca ucacguua au    g
   gga       gu       c  u        u  aaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15177v1; GCA_000151775.1) Overlapping transcripts
CABF01007794.1: 10259-10334 [-]
intergenic
Database links

Mature sequence sja-miR-3479-5p

Accession MIMAT0016274
Sequence

11 - 

agguggauguuagugcaauuua

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sja-miR-3479-3p

Accession MIMAT0016275
Sequence

45 - 

uauugcacuuaccuucgccuug

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).