Stem-loop sequence sja-mir-3484

AccessionMI0015307 (change log)
DescriptionSchistosoma japonicum miR-3484 stem-loop
Stem-loop
   gu  c    au       c           uuaucaa 
5'   ga aggu  uagguuu guuguuuguau       u
     || ||||  ||||||| |||||||||||       u
3'   cu ucca  auucaaa cgacaaacaua       u
   cu  a    au       u           cacaauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15177v1; GCA_000151775.1) Overlapping transcripts
CABF01005891.1: 21588-21664 [-]
intergenic
Database links

Mature sequence sja-miR-3484-5p

Accession MIMAT0016288
Sequence

11 - 

uuagguuucguuguuuguauuu

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sja-miR-3484-3p

Accession MIMAT0016289
Sequence

48 - 

auacaaacagcuaaacuuau

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).