Stem-loop sequence cin-mir-367

AccessionMI0015492 (change log)
DescriptionCiona intestinalis miR-367 stem-loop
Stem-loop
   ag        --        g   uaaua 
5'   ugcuauuc  augugcaa agu     c
     ||||||||  |||||||| |||      
3'   augguaag  uacacguu ucg     a
   --        gu        a   ugccg 
Get sequence
Deep sequencing
1748 reads, 550 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
1q: 161118-161173 [-]
intergenic
1q: 166124-166179 [-]
intergenic
scaffold_368: 39820-39875 [+]
intergenic
Clustered miRNAs
< 10kb from cin-mir-367
cin-mir-3671q: 166124-166179 [-]
cin-mir-4009c1q: 166023-166075 [-]
cin-mir-4009b1q: 165807-165858 [-]
cin-mir-3671q: 161118-161173 [-]
cin-mir-4009c1q: 161017-161069 [-]
cin-mir-4009a1q: 160902-160954 [-]
cin-mir-4009b1q: 160807-160858 [-]
Database links

Mature sequence cin-miR-367-5p

Accession MIMAT0016415
Sequence

1 - 

agugcuauucaugugcaaga

 - 20

Get sequence
Deep sequencing289 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-367-3p

Accession MIMAT0016416
Sequence

37 - 

uauugcacauuggaauggua

 - 56

Get sequence
Deep sequencing1459 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1