Stem-loop sequence cin-mir-92e

AccessionMI0015495 (change log)
DescriptionCiona intestinalis miR-92e stem-loop
Literature search

1 open access papers mention cin-mir-92e
(1 sentences)

Stem-loop
       g    ug      -   a  g 
5' cggu uggg  ggugca uga uc u
   |||| ||||  |||||| ||| || u
3' guca aucc  ucacgu auu ag g
       g    cu      u   a  u 
Get sequence
Deep sequencing
1422 reads, 350 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
1p: 2628718-2628769 [-]
intergenic
1p: 2635396-2635447 [-]
intergenic
Clustered miRNAs
< 10kb from cin-mir-92e
cin-mir-92b1p: 2635676-2635776 [-]
cin-mir-92e1p: 2635396-2635447 [-]
cin-mir-40381p: 2634947-2635001 [-]
cin-mir-92e1p: 2628718-2628769 [-]
Database links

Mature sequence cin-miR-92e-5p

Accession MIMAT0016421
Sequence

1 - 

cggugugggugggugcauga

 - 20

Get sequence
Deep sequencing1333 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-92e-3p

Accession MIMAT0016422
Sequence

33 - 

uauugcacuucccuagacug

 - 52

Get sequence
Deep sequencing89 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1