Stem-loop sequence cin-mir-92d

AccessionMI0015496 (change log)
DescriptionCiona intestinalis miR-92d stem-loop
Gene family MIPF0000509; mir-92
Literature search

1 open access papers mention cin-mir-92d
(1 sentences)

Stem-loop
   -     u uuu      uc     uaag 
5'  ggucg g   ggugua  auacu    c
    ||||| |   ||||||  |||||    a
3'  ccggc c   ccacgu  uauga    a
   g     c ugu      --     caca 
Get sequence
Deep sequencing
946 reads, 250 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
3p: 1864796-1864851 [+]
intergenic
Clustered miRNAs
< 10kb from cin-mir-92d
cin-mir-92a3p: 1864426-1864526 [+]
cin-mir-92d3p: 1864796-1864851 [+]
cin-mir-92c3p: 1865219-1865319 [+]
Database links

Mature sequence cin-miR-92d-5p

Accession MIMAT0016423
Sequence

1 - 

ggucguguuugguguaucau

 - 20

Get sequence
Deep sequencing917 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-92d-3p

Accession MIMAT0016424
Sequence

37 - 

uauugcaccugucccggccg

 - 56

Get sequence
Deep sequencing29 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1