Stem-loop sequence cin-mir-4009a

AccessionMI0015548 (change log)
DescriptionCiona intestinalis miR-4009a stem-loop
Stem-loop
   --   u uc         g   uauu 
5'   ggu u  cauguguaa agc    a
     ||| |  ||||||||| |||    u
3'   cca g  guacacguu ucg    g
   aa   u uu         a   uauc 
Get sequence
Deep sequencing
370 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
1q: 160902-160954 [-]
intergenic
scaffold_368: 40039-40091 [+]
intergenic
Clustered miRNAs
< 10kb from cin-mir-4009a
cin-mir-3671q: 166124-166179 [-]
cin-mir-4009c1q: 166023-166075 [-]
cin-mir-4009b1q: 165807-165858 [-]
cin-mir-3671q: 161118-161173 [-]
cin-mir-4009c1q: 161017-161069 [-]
cin-mir-4009a1q: 160902-160954 [-]
cin-mir-4009b1q: 160807-160858 [-]
Database links

Mature sequence cin-miR-4009a-5p

Accession MIMAT0016501
Sequence

1 - 

gguuuuccauguguaagagc

 - 20

Get sequence
Deep sequencing196 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-4009a-3p

Accession MIMAT0016502
Sequence

34 - 

uauugcacauguuguaccaa

 - 53

Get sequence
Deep sequencing174 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1