Stem-loop sequence cin-mir-4009b

AccessionMI0015549 (change log)
DescriptionCiona intestinalis miR-4009b stem-loop
Stem-loop
   --        u     u   g   aa 
5'   gguauguu agugu caa agc  g
     |||||||| ||||| ||| |||  c
3'   ccauguaa ucaca guu ucg  a
   uc        -     c   a   au 
Get sequence
Deep sequencing
381 reads, 150 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
1q: 160807-160858 [-]
intergenic
1q: 165807-165858 [-]
intergenic
scaffold_368: 40135-40186 [+]
intergenic
Clustered miRNAs
< 10kb from cin-mir-4009b
cin-mir-3671q: 166124-166179 [-]
cin-mir-4009c1q: 166023-166075 [-]
cin-mir-4009b1q: 165807-165858 [-]
cin-mir-3671q: 161118-161173 [-]
cin-mir-4009c1q: 161017-161069 [-]
cin-mir-4009a1q: 160902-160954 [-]
cin-mir-4009b1q: 160807-160858 [-]
Database links

Mature sequence cin-miR-4009b-5p

Accession MIMAT0016503
Sequence

1 - 

gguauguuuaguguucaaga

 - 20

Get sequence
Deep sequencing220 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-4009b-3p

Accession MIMAT0016504
Sequence

32 - 

uauugcacacuaauguacccu

 - 52

Get sequence
Deep sequencing161 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1