Stem-loop sequence cin-mir-4009c

AccessionMI0015550 (change log)
DescriptionCiona intestinalis miR-4009c stem-loop
Stem-loop
         c    -u    cc   uuau 
5' gguaca ugaa  ugca  agc    u
   |||||| ||||  ||||  |||     
3' ccaugu auuu  acgu  ucg    a
         c    uc    ua   ucuu 
Get sequence
Deep sequencing
16 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
1q: 161017-161069 [-]
intergenic
1q: 166023-166075 [-]
intergenic
scaffold_368: 39924-39976 [+]
intergenic
Clustered miRNAs
< 10kb from cin-mir-4009c
cin-mir-3671q: 166124-166179 [-]
cin-mir-4009c1q: 166023-166075 [-]
cin-mir-4009b1q: 165807-165858 [-]
cin-mir-3671q: 161118-161173 [-]
cin-mir-4009c1q: 161017-161069 [-]
cin-mir-4009a1q: 160902-160954 [-]
cin-mir-4009b1q: 160807-160858 [-]
Database links

Mature sequence cin-miR-4009c-3p

Accession MIMAT0016505
Sequence

34 - 

uauugcacuuuuacuguacc

 - 53

Get sequence
Deep sequencing16 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1