Stem-loop sequence cin-mir-4031

AccessionMI0015582 (change log)
DescriptionCiona intestinalis miR-4031 stem-loop
Stem-loop
       a    u   cg   a   uuaa 
5' ccca agug cgg  cau uuc    a
   |||| |||| |||  ||| |||     
3' gggu ucgc gcc  gua aag    u
       c    u   au   c   ccaa 
Get sequence
Deep sequencing
1093 reads, 350 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
1q: 7488678-7488731 [+]
intergenic
Database links

Mature sequence cin-miR-4031-5p

Accession MIMAT0016551
Sequence

1 - 

cccaaagugucggcgcauau

 - 20

Get sequence
Deep sequencing151 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-4031-3p

Accession MIMAT0016552
Sequence

35 - 

acauguaccgucgcucuggg

 - 54

Get sequence
Deep sequencing942 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1