Stem-loop sequence cin-mir-4037

AccessionMI0015588 (change log)
DescriptionCiona intestinalis miR-4037 stem-loop
Stem-loop
   aca     ac    c   a     -c  a 
5'    auugc  ucgu ugu ccgcc  cc u
      |||||  |||| ||| |||||  ||  
3'    uaacg  agca aca ggcgg  gg g
   ucg     gu    -   -     ua  c 
Get sequence
Deep sequencing
10821 reads, 4e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
scaffold_65: 663455-663511 [+]
intergenic
Clustered miRNAs
< 10kb from cin-mir-4037
cin-mir-4039scaffold_65: 663235-663284 [+]
cin-mir-4061scaffold_65: 663351-663400 [+]
cin-mir-4037scaffold_65: 663455-663511 [+]
cin-mir-4052scaffold_65: 663557-663606 [+]
Database links

Mature sequence cin-miR-4037-5p

Accession MIMAT0016563
Sequence

1 - 

acaauugcacucgucuguaccg

 - 22

Get sequence
Deep sequencing10779 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-4037-3p

Accession MIMAT0016564
Sequence

38 - 

cggacaacgauggcaaugcu

 - 57

Get sequence
Deep sequencing42 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1