Stem-loop sequence cin-mir-4038

AccessionMI0015589 (change log)
DescriptionCiona intestinalis miR-4038 stem-loop
Stem-loop
   c        c   a     au   guu 
5'  ggucaaua cag ugcaa  caa   c
    |||||||| ||| |||||  |||    
3'  cuaguuau guc acguu  guu   a
   u        u   -     ac   gua 
Get sequence
Deep sequencing
11047 reads, 3.6e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
1p: 2634947-2635001 [-]
intergenic
Clustered miRNAs
< 10kb from cin-mir-4038
cin-mir-92b1p: 2635676-2635776 [-]
cin-mir-92e1p: 2635396-2635447 [-]
cin-mir-40381p: 2634947-2635001 [-]
cin-mir-92e1p: 2628718-2628769 [-]
Database links

Mature sequence cin-miR-4038-5p

Accession MIMAT0016565
Sequence

1 - 

cggucaauaccagaugcaaa

 - 20

Get sequence
Deep sequencing25 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-4038-3p

Accession MIMAT0016566
Sequence

36 - 

cauugcacuguuauugaucu

 - 55

Get sequence
Deep sequencing11022 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1