Stem-loop sequence cin-mir-4061

AccessionMI0015612 (change log)
DescriptionCiona intestinalis miR-4061 stem-loop
Stem-loop
   a     uc c     ug      a 
5'  ggcgg  c ucaga  guuucg u
    |||||  | |||||  ||||||  
3'  cugcc  g ggucu  caaagu u
   a     uu c     ca      c 
Get sequence
Deep sequencing
469 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
scaffold_65: 663351-663400 [+]
intergenic
Clustered miRNAs
< 10kb from cin-mir-4061
cin-mir-4039scaffold_65: 663235-663284 [+]
cin-mir-4061scaffold_65: 663351-663400 [+]
cin-mir-4037scaffold_65: 663455-663511 [+]
cin-mir-4052scaffold_65: 663557-663606 [+]
Database links

Mature sequence cin-miR-4061-5p

Accession MIMAT0016610
Sequence

1 - 

aggcggucccucagaugguu

 - 20

Get sequence
Deep sequencing457 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-4061-3p

Accession MIMAT0016611
Sequence

31 - 

aacacucuggcguuccguca

 - 50

Get sequence
Deep sequencing12 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1