Stem-loop sequence cin-mir-4070

AccessionMI0015621 (change log)
DescriptionCiona intestinalis miR-4070 stem-loop
Stem-loop
   u   a       ca   a      -c  ca 
5'  cga uguuaug  ggc cgugca  gu  u
    ||| |||||||  ||| ||||||  ||   
3'  gcu acagugc  cug gcacgu  cg  a
   -   -       -a   c      au  ag 
Get sequence
Deep sequencing
22 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
5q: 864845-864902 [-]
intergenic
Clustered miRNAs
< 10kb from cin-mir-4070
cin-mir-40865q: 864977-865032 [-]
cin-mir-40705q: 864845-864902 [-]
cin-mir-40665q: 864513-864560 [-]
cin-mir-40855q: 863886-863941 [-]
cin-mir-40565q: 863632-863684 [-]
Database links

Mature sequence cin-miR-4070-5p

Accession MIMAT0016628
Sequence

1 - 

ucgaauguuaugcaggcacgug

 - 22

Get sequence
Deep sequencing22 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-4070-3p

Accession MIMAT0016629
Sequence

40 - 

cacgcgucacgugacaucg

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1