Stem-loop sequence cin-mir-4092

AccessionMI0015645 (change log)
DescriptionCiona intestinalis miR-4092 stem-loop
Stem-loop
   cg       g   ac   aa     c 
5'   uguugug aga  gac  uagcg a
     ||||||| |||  |||  ||||| a
3'   acgacac ucu  cug  aucgu c
   -a       a   gu   -g     u 
Get sequence
Deep sequencing
141 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
4q: 181157-181209 [+]
intergenic
Database links

Mature sequence cin-miR-4092-5p

Accession MIMAT0016670
Sequence

1 - 

cguguuguggagaacgacaa

 - 20

Get sequence
Deep sequencing24 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-4092-3p

Accession MIMAT0016671
Sequence

34 - 

uaggucugucuacacagcaa

 - 53

Get sequence
Deep sequencing117 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1