Stem-loop sequence cin-mir-4096

AccessionMI0015649 (change log)
DescriptionCiona intestinalis miR-4096 stem-loop
Stem-loop
        -uuu    a    g ug     u ug  u 
5' cacaa    gcua auug c  aaacu u  ua u
   |||||    |||| |||| |  ||||| |  ||  
3' guguu    cgau uaac g  uuuga a  au g
        uuau    a    - --     c gu  g 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cin-miR-4096-3p

Accession MIMAT0016677
Sequence

47 - 

ugcaauauagcuauuuugug

 - 66

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1