Stem-loop sequence cin-mir-4177

AccessionMI0015732 (change log)
DescriptionCiona intestinalis miR-4177 stem-loop
Stem-loop
                        aaucgaaa    c u    aac 
5' uauuuuuaaaacagcaauuaa        ccca u uuaa   a
   |||||||||||||||||||||        |||| | ||||    
3' auaaaaauuuugucguuaauu        gggu a aauu   g
                        -------g    u c    aac 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
2q: 5092762-5092842 [-]
intergenic
Database links

Mature sequence cin-miR-4177-5p

Accession MIMAT0016786
Sequence

1 - 

uauuuuuaaaacagcaauua

 - 20

Get sequence
Deep sequencing11 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence cin-miR-4177-3p

Accession MIMAT0016787
Sequence

62 - 

uaauugcuguuuuaaaaaua

 - 81

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1