Stem-loop sequence bmo-mir-92a

AccessionMI0015936 (change log)
DescriptionBombyx mori miR-92a stem-loop
Gene family MIPF0000013; mir-25
Literature search

5 open access papers mention bmo-mir-92a
(17 sentences)

Stem-loop
   g          c     a u      c  c     cg   c 
5'  gcccguuugg ugggc g gacugg gc auauu  gua g
    |||||||||| ||||| | |||||| || |||||  |||  
3'  cgggcgagcc auccg c cugacc cg uauag  cgu u
   -          u     g c      a  u     --   g 
Get sequence
Deep sequencing
94 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581739.1: 696247-696327 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-92a
bmo-mir-92aNW_004581739.1: 696247-696327 [-]
bmo-mir-92bNW_004581739.1: 696074-696161 [-]
Database links

Mature sequence bmo-miR-92a

Accession MIMAT0016927
Sequence

50 - 

uauugcaccagucccggccuau

 - 71

Get sequence
Deep sequencing94 reads, 3 experiments
Evidence not experimental
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).