Stem-loop sequence rlcv-mir-rL1-34

AccessionMI0015355 (change log)
DescriptionRhesus lymphocryptovirus miR-rL1-34 stem-loop
Stem-loop
   caaacaa   u     cuuua       uaa a   -      u  a 
5'        ggc guagc     gauggcg   c ggc aacuug gu u
          ||| |||||     |||||||   | ||| |||||| || g
3'        ucg cgucg     cuaucgc   g ccg uugaac cg a
   cucuacc   u     uauac       caa c   a      -  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rlcv-miR-rL1-34-5p

Accession MIMAT0016960
Sequence

20 - 

uagauggcguaacaggcaacu

 - 40

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence rlcv-miR-rL1-34-3p

Accession MIMAT0016961
Sequence

57 - 

uuagcccgaaccgcuauccaua

 - 78

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20219930 "Comprehensive analysis of Rhesus lymphocryptovirus microRNA expression" Riley KJ, Rabinowitz GS, Steitz JA J Virol. 84:5148-5157(2010).
2
PMID:24257599 "Evolutionary conservation of primate lymphocryptovirus microRNA targets" Skalsky RL, Kang D, Linnstaedt SD, Cullen BR J Virol. 88:1617-1635(2014).